If you have been reading about regulatory status and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2026-07-16. Numbers and descriptions here follow the published literature rather than marketing material.
Safety concerns emerged from long-term animal studies. In rodents given the compound for extended periods, researchers found an increased incidence of certain cancers, including liver and bladder tumors. These findings contributed to the discontinuation of clinical development. Whether similar risks apply to short-term or low-level exposure in humans is not established, and controlled human safety data are limited. The relevance of high-dose rodent carcinogenicity findings to human use remains a subject of debate.
Human trials of GW501516 were small and short in duration. They examined lipid levels, glucose handling, and other metabolic markers, but the programs were halted after the animal cancer findings. No approved therapeutic product exists, and published human data are insufficient for establishing long-term safety. Reports of use for athletic performance come mainly from non-clinical settings and cannot be verified through controlled trials. Independent testing of products sold as cardarine has found inconsistent purity and labeling.
Legal status varies by country. In some places, cardarine is controlled under medicines or psychoactive substances laws; in others, it may be sold with minimal oversight as a research chemical. Customs agencies have intercepted shipments, and several national health agencies have issued warnings about products marketed for bodybuilding or performance enhancement. The lack of a standardized pharmaceutical supply means identity, purity, and contamination levels can differ widely between samples. These factors make cardarine a regulatory and public health concern rather than a conventional prescription drug.
Cardarine is a common name for GW501516, a synthetic compound first described in the 1990s as a selective agonist of the peroxisome proliferator-activated receptor delta. It was studied in preclinical models for metabolic and cardiovascular conditions, but it has not been approved as a medicine in the United States, Europe, or other major jurisdictions. Retail products labeled as cardarine are generally research chemicals or supplements, not pharmaceutical formulations. Because human safety and efficacy data remain limited, regulatory agencies treat it as an unapproved substance rather than a therapeutic product.
Sporting authorities added GW501516 to prohibited lists after it appeared in athlete samples and online markets. The World Anti-Doping Agency classifies it as a hormone and metabolic modulator, and its use can lead to an anti-doping rule violation. Some early laboratory work suggested effects on fatty acid oxidation and endurance-related metabolism in animals, but those findings do not establish safe or effective use in people. Reports of adverse events in humans are scarce and often anecdotal, which complicates risk assessment.
| Property | Value | Notes |
|---|---|---|
| Primary target | PPARδ (NR1C2) | Nuclear receptor involved in lipid metabolism |
| Preclinical effect | Increased fatty acid oxidation | Observed in rodent studies |
| Key safety signal | Tumors in rodents after long-term exposure | Contributed to halted clinical development |
| Human trial status | No approved product; development stopped | Limited short-term metabolic data |
| Sport regulatory status | Prohibited at all times | WADA hormone and metabolic modulators class |
In the fitness and bodybuilding literature, cardarine is frequently discussed as an endurance agent or fat-loss compound, although such claims are not supported by robust clinical evidence. Online descriptions often mix animal data, user anecdotes, and marketing language. Researchers who study PPARδ agonists distinguish between receptor activation in controlled experiments and unsupervised use of unverified products. The latter introduces unknown purity, dose, and interactions, making reported experiences difficult to interpret scientifically.
GW501516 acts as an agonist at peroxisome proliferator-activated receptor delta, a nuclear receptor involved in transcription of genes related to lipid handling and energy use. Activation of PPARδ can shift skeletal muscle toward greater fatty acid oxidation in animal models, which is one reason it drew interest for metabolic disease and exercise research. The exact downstream effects depend on tissue, species, dose, and duration. Human data are sparse, so many proposed benefits remain hypotheses rather than established clinical outcomes.
Published studies have examined GW501516 in animal models of obesity, insulin resistance, and exercise endurance. Early human trials reportedly ended, and development was discontinued after preclinical findings raised concerns about cancer in some rodent studies. Regulatory agencies have not approved cardarine for any medical use. Its availability through non-pharmaceutical channels raises questions about identity, purity, and legal status that are separate from its laboratory pharmacology. Those questions are often addressed through analytical testing rather than assumptions about product labels.
Cardarine is a common name for GW501516, also GW-1516, a synthetic compound developed as a peroxisome proliferator-activated receptor delta (PPARδ) agonist. It belongs to a class of agents that modulate gene transcription related to lipid and energy metabolism. The compound was studied in preclinical and early clinical research for metabolic and cardiovascular conditions, but it did not progress to approved therapeutic use. Its name appears in fitness and sports contexts despite not being approved as a drug.
PPARδ is a nuclear receptor that influences transcription of genes involved in fatty acid oxidation, lipid transport, and energy homeostasis. GW501516 binds and activates this receptor with high selectivity relative to PPARα and PPARγ in laboratory assays. Activation alters expression of target genes in skeletal muscle, liver, and adipose tissue in animal models. The exact clinical consequences of these changes in humans remain incompletely characterized, and observed effects in animals do not establish therapeutic benefit or safety.
Evidence from the study of nuclear and mitochondrial genomes Paleolithic dog remains, indicative of presence and wide distribution of a genetically homogeneous dog population across Europe and Anatolia by at least 14,300 years ago, is presented by Marsh et al. (2026). Bergström et al. (2026) reconstruct the evolutionary history of early European dogs on the basis of the study of ancient DNA from Paleolithic and Mesolithic remains, reporting evidence of genetic diversification of European dogs before 14,200 years ago, and evidence of contribution of Mesolithic dogs to the ancestry of later, Neolithic European dogs. Kropczyk & Marciszak (2026) study the composition of the canid assemblage from caves from Mount Połom (Poland), including Pleistocene wolves that are morphologically comparable with extant wolves and only slightly smaller, representing one of the oldest large-bodied wolves in Europe reported to date. Purported partial dentary of a member of the genus Plionarctos from the Miocene Rattlesnake Formation (Oregon, United States) is considered to be only identifiable as belonging to an indeterminate bear by Schubert & Samuels (2026), who consider Plionarctos edensis from the latest Hemphillian Mt. Eden Local Fauna from California to be oldest known confirmed short-faced bear. Ruiz-Ramoni et al. (2026) identify fossil material of a specimen of Arctotherium wingei from Taima-Taima (Venezuela), find A. wingei to be the only species of Arctotherium present in the region, and review the fossil record of bears in Venezuela. Lopatin et al.
== Chemistry == Chemical constituents of the roots (Radix Astragali) include polysaccharides and triterpenoids (such as astragalosides), as well as isoflavones (including kumatakenin, calycosin, and formononetin) and their glycosides and malonates. It contains the saponin cycloastragenol.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Long-term administration of spironolactone gives the histologic characteristic of "spironolactone bodies" in the adrenal cortex, which are eosinophilic, round, concentrically laminated cytoplasmic inclusions surrounded by clear halos in preparations stained with hematoxylin and eosin.
The Ukrainian Defence Ministry said that its forces had retaken about 20sq km (7.5sq miles) of territory from Russian forces in the north and south of the outskirts of Bakhmut in recent days while acknowledging continued Russian advances inside the city. The Wagner Group's head Yevgeny Prigozhin claimed that an American citizen was killed fighting in Bakhmut, in a video posted on Telegram that showed him inspecting a body and what he claimed to be US identification documents. In Kharkiv Oblast, two people where killed in another bout of Russian shelling in Dvorichna. South African President Cyril Ramaphosa said both Presidents Putin and Zelenskyy had agreed to receive an African mission that would propose a peace plan. He said the plan was backed by the presidents of Senegal, Uganda and Egypt and that UN Secretary-General António Guterres, the United States and the United Kingdom had also been briefed. The commander of the land forces of the South African National Defence Force, Lieutenant-General Lawrence Mbatha, visited Moscow. A Moscow court sentenced Colombian resident and Russian passport-holder Alberto Enrique Giraldo Saray to five years and two months in prison for spreading "fake news" about the actions of the Russian military in Ukraine. The US State Department condemned the arrest of a local embassy employee in Russia for alleged spying.
Sources: en.wikipedia.org
Chester Fisher died in 1965 at age 84. His sons maintained leadership of the company, with Aiken becoming Chairman and Benjamin becoming president. The youngest son, James Fisher, had the title Senior Vice President. Fisher Scientific Company issued its first public stock in 1965, and that year the company had $58 million in sales and close to a million customer transactions. In 1968 Fisher shares were listed on the New York Stock Exchange. In 1965 the company introduced the Differential Thermalyzer, a differential thermal analysis instrument. It acquired Pfeiffer Glass, Inc. in 1966, a manufacturer of high accuracy volumetric pipettes. The company released the Photometric Titralyzer that year, and a Hem-alyzer in 1968. In 1968, it purchased Massachusetts-based Jarrell-Ash Company, a producer of optical instrumentation, particularly for emission and atomic absorption spectroscopy. It acquired Chicago-based Stansi Scientific Company in 1967, expanding into educational science supplies. In 1976, Fisher Scientific established an Instrument Service Division. Fisher was acquired by Morristown, New Jersey–based Allied Corporation in 1981 for $330 million. At this time Benjamin R. Fisher was Chairman of the company, having gained the position in 1975 upon Aiken's retirement. Operating as a subsidiary of Allied Corporation (and later AlliedSignal Inc., and The Henley Group), Fisher established a Biotechnology Division in 1985. In 1991, The Henley Group sold a majority interest in Fisher through a public stock offering.
Regarding this, San Francisco attorney Alex Coolman has commented, "It's remarkable that Chidester's parents, and only Chidester's parents, continue to be cited over and over again by the mainstream media in their coverage of the supposed 'controversy' over the risks of Salvia divinorum." Kathleen Chidester has continued campaigning for "Schedule I"-like legislation beyond their home state of Delaware. For example, three years after Brett's death, in written testimony in support of Senator Richard Colburn's proposed Senate Bill to the Maryland State Legislature, saying, "My hope and goal is to have salvia regulated across the US. It's my son's legacy and I will not end my fight until this happens."
==== Heart ==== Since the number of patients awaiting a heart transplant is continuously increasing over time, and the number of patients on the waiting list surpasses the organ availability, artificial organs used as replacement therapy for terminal heart failure would help alleviate this difficulty. Artificial hearts are usually used to bridge the heart transplantation or can be applied as replacement therapy for terminal heart malfunction. The total artificial heart (TAH), first introduced by Dr. Vladimir P. Demikhov in 1937, emerged as an ideal alternative. Since then it has been developed and improved as a mechanical pump that provides long-term circulatory support and replaces diseased or damaged heart ventricles that cannot properly pump the blood, restoring thus the pulmonary and systemic flow. Some of the current TAHs include AbioCor, an FDA-approved device that comprises two artificial ventricles and their valves, and does not require subcutaneous connections, and is indicated for patients with biventricular heart failure. In 2010 SynCardia released the portable freedom driver that allows patients to have a portable device without being confined to the hospital.
Overview Although the Culture is a type of utopian anarchy, Minds most closely approach the status of leaders, and would likely be considered godlike in less rational societies. As independent, thinking beings, each has its own character, and indeed, legally (insofar as the Culture has a 'legal system'), each is a Culture citizen. Some Minds are more aggressive, some more calm; some don't mind mischief, others simply demonstrate intellectual curiosity. But above all they tend to behave rationally and benevolently in their decisions. As mentioned before, Minds can serve several different purposes, but Culture ships and habitats have one special attribute: the Mind and the ship or habitat are perceived as one entity; in some ways the Mind is the ship, certainly from its passengers' point of view. It seems normal practice to address the ship's Mind as "Ship" (and an Orbital hub as "Hub"). However, a Mind can transfer its 'mind state' into and out of its ship 'body', and even switch roles entirely, becoming (for example) an Orbital Hub from a warship. More often than not, the Mind's character defines the ship's purpose. Minds do not end up in roles unsuited to them; an antisocial Mind simply would not volunteer to organise the care of thousands of humans, for example. On occasion groupings of two or three Minds may run a ship. This seems normal practice for larger vehicles such as GSVs, though smaller ships only ever seem to have one Mind. Banks also hints at a Mind's personality becoming defined at least partially before its creation or 'birth'.
The shells of green sea turtles and loggerhead sea turtles have been found in white shark stomachs in the Mediterranean, and bites have been recorded on leatherback sea turtles off central California. Around Seal Island, South Africa, white sharks are recorded to attack and kill seabirds like Cape cormorants, white-breasted cormorants, kelp gulls, Cape gannets, brown skuas, sooty shearwaters, and African penguins but rarely consume them.
Sources: en.wikipedia.org
In the New Testament, the Epistle to the Colossians sets out a partial list: "everything visible and everything invisible, Thrones, Dominions, Sovereignties, Powers – all things were created through him and for him." The Epistle to the Ephesians also lists several entities: "Far above all principality, and power, and might, and dominion, and every name that is named, not only in this world, but also in that which is to come". In the 5th and 6th centuries, Pseudo-Dionysius the Areopagite set out a more elaborate hierarchy, consisting of three lists, each of three types:
Sendai virus is used as a backbone for vaccine development against Mycobacterium tuberculosis that causes tuberculosis, against HIV-1 that causes AIDS and against other viruses, including those that cause severe respiratory infections in children. The latter include human respiratory syncytial virus (HRSV), human metapneumovirus (HMPV) and human parainfluenza viruses (HPIV). The vaccine studies against M. tuberculosis, HMPV, HPIV1 and, HPIV2 are in the pre-clinical stage, against HRSV a phase I clinical trial has been completed. The phase I clinical studies of SeV-based vaccination were also completed for HPIV1. They were done in adults and in 1–6-year-old children. As a result of vaccination against HPIV1, a significant boost in virus-specific neutralizing antibodies was observed. A SeV-based vaccine development against HIV-1 has reached a phase II clinical trial. In Japan intranasal Sendai virus-based SARS-CoV-2 vaccine was created and tested in a mouse model. More recent applications (2024–2025) include non-integrative gene delivery for fertility restoration in mouse models, enhanced transduction in pancreatic cancer, and temperature-sensitive platforms for CRISPR-Cas9 editing in human stem cells and viral genome engineering.
The study of pathology, including the detailed examination of the body, dissection and inquiry into specific maladies, dates back to antiquity. Rudimentary understanding of many conditions was present in most early societies and is attested to in the records of the earliest historical societies, including those of the Middle East, India, and China. By the Hellenic period of ancient Greece, a concerted causal study of disease was underway (see Medicine in ancient Greece), with many notable early physicians (such as Hippocrates, for whom the modern Hippocratic Oath is named) having developed methods of diagnosis and prognosis for a number of diseases. The medical practices of the Romans and those of the Byzantines continued from these Greek roots, but, as with many areas of scientific inquiry, growth in understanding of medicine stagnated somewhat after the Classical Era, but continued to slowly develop throughout numerous cultures. Notably, many advances were made in the medieval era of Islam (see Medicine in medieval Islam), during which numerous texts of complex pathologies were developed, also based on the Greek tradition. Even so, growth in complex understanding of disease mostly languished until knowledge and experimentation again began to proliferate in the Renaissance, Enlightenment, and Baroque eras, following the resurgence of the empirical method at new centers of scholarship.
The units and notation above are used when dealing with the physics of mass spectrometry; however, the m/z notation is used for the independent variable in a mass spectrum. This notation eases data interpretation since it is numerically more related to the dalton. For example, if an ion carries one charge the m/z is numerically equivalent to the molecular or atomic mass of the ion in daltons (Da), where the numerical value of m/Q is abstruse. The m refers to the molecular or atomic mass number (number of nucleons) and z to the charge number of the ion; however, the quantity of m/z is dimensionless by definition. An ion with a mass of 100 Da (daltons) (m = 100) carrying two charges (z = 2) will be observed at m/z 50. However, the empirical observation m/z 50 is one equation with two unknowns and could have arisen from other ions, such as an ion of mass 50 Da carrying one charge. Thus, the m/z of an ion alone neither infers mass nor the number of charges. Additional information, such as the mass spacing between mass isotopomers or the relationship between multiple charge states, is required to assign the charge state and infer the mass of the ion from the m/z. This additional information is often but not always available. Thus, the m/z is primarily used to report an empirical observation in mass spectrometry. This observation may be used in conjunction with other lines of evidence to subsequently infer the physical attributes of the ion, such as mass and charge. On rare occasions, the thomson has been used as a unit of the x-axis of a mass spectrum.
=== Names === Levodopa is the generic name of the drug and its INNTooltip International Nonproprietary Name, USANTooltip United States Adopted Name, USPTooltip United States Pharmacopeia, BANTooltip British Approved Name, DCFTooltip Dénomination Commune Française, DCITTooltip Denominazione Comune Italiana, and JANTooltip Japanese Accepted Name.
Sources: en.wikipedia.org
Rodent studies reported increased endurance and fat oxidation after GW501516 exposure. Long-term studies also found higher rates of some tumors, which led to halted development.
Small short-term human trials examined metabolic markers such as lipids and glucose. The trials did not continue after rodent cancer findings, so long-term human safety is unknown.
Controlled human trials have not established a performance benefit. Anecdotal reports exist, but they are not reliable evidence.
No. Major drug regulators have not approved GW501516 for treating any medical condition. Products sold as cardarine are typically unapproved research chemicals or supplements, so their contents and safety are not assured.